Journal: eLife

Article Title: Inhibition of ErbB kinase signalling promotes resolution of neutrophilic inflammation

doi: 10.7554/eLife.50990

Figure Lengend Snippet: Kinexus antibody microarray analysis. Ultrapurified neutrophils were incubated with N 6 -MB-cAMP [100 µM] for 30 and 60 min or lysed immediately following isolation (0’). Lysates from four donors were pooled prior to Kinex antibody microarray analysis. Table shows all targets for which phospho-antibodies had Z ratios of >1.5 compared to t = 0 baseline control, at each timepoint. ErbB related antibodies are in bold.

Article Snippet: Transient dual knockdown of egfra and erbb2 was induced using a Cas9 nuclease (New England Biolabs) in combination with transactivating RNA (tracr) and synthetic guide RNAs specific to zebrafish egfra and erbb2 genes (Merck).

Techniques: Microarray, Incubation, Isolation

Journal: eLife

Article Title: Inhibition of ErbB kinase signalling promotes resolution of neutrophilic inflammation

doi: 10.7554/eLife.50990

Figure Lengend Snippet: ( A ) ErbB2 was detected in neutrophils and the positive control cell line, BEAS-2B, by RT-PCR. Primer sequences are as follows: ErbB2 forward: ACCCAGCTCTTTGAGGACAA , reverse: ATCGTGTCCTGGTAGCAGAG and β-actin forward: ATATCGCCGCGCTCGTCGTC , reverse: TAGCCGCGCTCGGTGAGGAT . NTC – no template control. ( B ) Neutrophils were treated with GMCSF [50 u/mL] and dbcAMP [10 μM] for 5 hr and lysates subjected to SDS PAGE. Membranes were immunoblotted with antibodies to ErbB2 antibody or β-actin as a loading control. A 60kD band was detected which was upregulated by GMCSF and dbcAMP. The image is representative of three independent experiments. ( C ) ErbB3 was detected by ELISA in human neutrophils and the positive control cell line, HaCaT. Neutrophils were treated with media, dbcAMP [500 µM], GM-CSF [50 u/mL] or LPS [1 µg/mL] for 2 hr or 6 hr, after which lysates were collected and ELISA detecting total human ErbB3 was carried out (N = 4). Bars indicate mean + SEM and statistical differences between media control and treatments were measured by one-way ANOVA and Sidak post-test (C, ns).

Article Snippet: Transient dual knockdown of egfra and erbb2 was induced using a Cas9 nuclease (New England Biolabs) in combination with transactivating RNA (tracr) and synthetic guide RNAs specific to zebrafish egfra and erbb2 genes (Merck).

Techniques: Positive Control, Reverse Transcription Polymerase Chain Reaction, SDS Page, Enzyme-linked Immunosorbent Assay

Journal: eLife

Article Title: Inhibition of ErbB kinase signalling promotes resolution of neutrophilic inflammation

doi: 10.7554/eLife.50990

Figure Lengend Snippet: Tail fin transection was performed as indicated by the red line ( A , upper image). Zebrafish larvae ( mpx :GFP) were pre-treated at two dpf with DMSO, tyrphostin AG825 [Tyr, 10 µM] ( B , minimum n = 28 larvae per condition), or CP-724714 [10 µM] ( C , minimum n = 42 larvae per condition) for 16 hr followed by injury. egfra and erbb2 crispants were generated and injured at two dpf ( D , minimum n = 36 larvae per condition). The number of neutrophils at the site of injury was determined at 4 and 8 hpi by counting GFP-positive neutrophils. To enumerate neutrophils across the whole body, uninjured inhibitor treated larvae (three dpf) ( E , minimum n = 23 larvae per condition) or crispants (two dpf) ( F , minimum n = 28 larvae per condition) were imaged by fluorescent microscopy (A, lower image). Apoptosis was measured at the site of injury after 8 hr by TSA and TUNEL double staining ( G ) (white arrow indicates TUNEL positive neutrophil, scale bar 10 μM) of mpx: GFP tyrphostin AG825 [Tyr, 10 µM] or CP-724714 [10 µM] treated larvae at three dpf ( H , minimum n = 35 larvae per condition). Uninjured inhibitor treated larvae were assessed for neutrophil apoptosis in the CHT at three dpf ( I , minimum n = 27 larvae per group). Apoptosis at the tail fin injury site of egfra erbb2 crispants at two dpf was also measured at eight hpi ( J , minimum n = 26 larvae per group). All data collated from at least three independent experiments, displayed as mean ± SEM. Each icon shows one data point from one individual larvae. Statistically significant differences were calculated by two-way ANOVA with Sidak post-test ( B–D ) or one-way ANOVA with Dunnett’s post-test(E), Students’ t-test ( F ), Kruskal-Wallis test with Dunn’s post-test ( H–I ) or Mann-Whitney U test ( J ), and indicated as *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

Article Snippet: Transient dual knockdown of egfra and erbb2 was induced using a Cas9 nuclease (New England Biolabs) in combination with transactivating RNA (tracr) and synthetic guide RNAs specific to zebrafish egfra and erbb2 genes (Merck).

Techniques: Generated, Microscopy, TUNEL Assay, Double Staining, MANN-WHITNEY

Journal: eLife

Article Title: Inhibition of ErbB kinase signalling promotes resolution of neutrophilic inflammation

doi: 10.7554/eLife.50990

Figure Lengend Snippet:

Article Snippet: Transient dual knockdown of egfra and erbb2 was induced using a Cas9 nuclease (New England Biolabs) in combination with transactivating RNA (tracr) and synthetic guide RNAs specific to zebrafish egfra and erbb2 genes (Merck).

Techniques: Sequencing

Journal: Oncotarget

Article Title: Methylation of promoter of RBL1 enhances the radioresistance of three dimensional cultured carcinoma cells

doi: 10.18632/oncotarget.12647

Figure Lengend Snippet: A . Microarray analysis of 84 cell cycle regulation genes expression profile in 2D and 3D A549 cells 12h after irradiation with 4Gy X-rays. B . Venn diagrams of different expression of 84 cell cycle genes. C . Relative expression levels of RBL1, CCND1 and CCNF were measured by qRT-PCR at the indicated time points after 4 Gy X-rays in 2D and 3D A549 cells. GAPDH were used as internal control. D . The expressions of RBL1, CCND1 and CCNF at the indicated time points after 4 Gy X-rays in 2D and 3D A549 cells by western blot assay. Each data point represents the mean of three separate experiments. Bars are the standard errors. Significance was determined by Student's t-test. *, P < 0.05; **, P < 0.01.

Article Snippet: The primary antibodies include: RBL1 (1:1000, Proteintech, China), CCND1, CCNF (1:1000, Affinity Biosciences, USA) and GAPDH (1:1000, ZSGB-BIO, Beijing, China).

Techniques: Microarray, Expressing, Irradiation, Quantitative RT-PCR, Control, Western Blot

Journal: PLoS ONE

Article Title: Genome Wide Expression Profiling during Spinal Cord Regeneration Identifies Comprehensive Cellular Responses in Zebrafish

doi: 10.1371/journal.pone.0084212

Figure Lengend Snippet: A) Dendrogram representing genes related to regulation of inflammation. Each horizontal line indicates the expression pattern of each gene and the vertical columns indicate the uninjured control and time points after SCI. The color chart indicates mean fold change of gene expression in each time points. Red and green colors represent increased and decreased expression respectively. B) Quantitative RT-PCR of stat3 expression showing fold change (red graph) and pattern of expression at different time points after injury. The temporal expression pattern of qRT-PCR (red graph) was compared with results of microarray analysis (blue graph). Error bars represent SEM, n = 3, p<0.01. C) A longitudinal section of uninjured cord stained with STAT3 and DAPI. D) A longitudinal section of 1 dpi cord showing many STAT3 positive cells (white arrows) close to the injury epicenter (double white stars) counter stained with DAPI. E–H) A longitudinal section of 3 dpi cord double stained with STAT3 and radial glial marker- GFAP, showing individual panels of STAT3 (E), GFAP (F), merge with DAPI (G) and DIC (Differential interference contrast) (H). A few STAT3 + cells are colocalized with GFAP + cells (white arrowheads) close to injury epicenter. I–L) A longitudinal section of 3 dpi cord showing colocalization of STAT3 and newly formed neuronal marker, HuC/D with individual panels of STAT3 (I), HuC/D (J), merge with DAPI (K) and DIC (L). Some of the STAT3 + cells are colocalized with HuC/D + cells (yellow arrowheads) close to the injury epicenter. M–P) A longitudinal section of 3 dpi cord colocalized with STAT3 and proliferating cell marker, BrdU shows individual panels of STAT3 (M), BrdU (N), merge (O) and DIC (P). Proliferating BrdU + cells are also colocalized with STAT3 + cells (blue arrowheads) close to the injury epicenter. White dashed line in panel C to P mark the boundary of spinal cord tissue. Q–T) A representative higher magnification of 3 dpi cord section shows individual panels like STAT3 (Q), GFAP (R), DAPI (S) and merge (T). A STAT3 + cell (white arrowhead; the boundary of the cell nucleus is markedby white dashed line) is colocalized with GFAP + radial glia (white arrowhead; the boundary of the cytoplasm of radial glia is marked by white dashed line). U–X) A representative higher magnification of 3 dpi cord section shows individual panels like STAT3 (U), HuC/D (V), DAPI (W) and merge (X). A STAT3 + cell (yellow arrowhead; the boundary of the cell nucleus is marked by white dashed line) is colocalized with HuC/D + newly formed neuron close to ependyma (yellow arrowhead; the boundary of the cell nucleus is marked by white dashed line). Y) Quantitative analysis of STAT3 + , STAT3 + /GFAP + , STAT3 + /HuC/D + and STAT3 + /BrdU + cells in 3 dpi cord in longitudinal sections. The value represented as Mean±SEM of individual longitudinal section, n = 5 cord, p<0.01.Scale bar = 200 µm (C–D); 50 µm (E–P), 20 µm (Q–X).

Article Snippet: Immunostaining was performed as described previously by using the following primary antibodies shown to specifically recognize fish, amphibian and human proteins: anti- HuC/D (1∶50, Molecular Probes, USA), anti- TGFβ (1∶100, Santa Cruz Biotech, USA), anti- STAT3 (1∶100, Santa Cruz, USA), anti- GFAP (1∶400, DAKO), anti- SOX2 (1∶200, Abcam, USA), anti- BrdU (1∶200, Sigma, USA), anti- Phospho-histone H3 (H3P, 1∶400, Cell Signaling Technology, USA).

Techniques: Expressing, Control, Gene Expression, Quantitative RT-PCR, Microarray, Staining, Marker